sgRNA BRCA2 S3070F
(Plasmid
#139325)
-
PurposePlasmid expressing a sgRNA to introduce BRCA2 S3070F using base editing
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 139325 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneB52 (Addgene #100708)
- Backbone size w/o insert (bp) 2633
- Total vector size (bp) 2637
-
Modifications to backboneInsertion of the sgRNA at the BbsI cloning site. The BsmBI cloning site is still available to express a second sgRNA.
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namesgRNA to insert BRCA2 S3070F using base editing
-
Alt namesgRNA sequence: GTTCTGAGGTGGACCTAAT
-
SpeciesH. sapiens (human)
-
Insert Size (bp)19
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BbsI (destroyed during cloning)
- 3′ cloning site BbsI (destroyed during cloning)
- 5′ sequencing primer GAGGTACCTCGAGGAATTCTCTAGA (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
sgRNA BRCA2 S3070F was a gift from Alberto Ciccia (Addgene plasmid # 139325 ; http://n2t.net/addgene:139325 ; RRID:Addgene_139325) -
For your References section:
Detection of Marker-Free Precision Genome Editing and Genetic Variation through the Capture of Genomic Signatures. Billon P, Nambiar TS, Hayward SB, Zafra MP, Schatoff EM, Oshima K, Dunbar A, Breinig M, Park YC, Ryu HS, Tschaharganeh DF, Levine RL, Baer R, Ferrando A, Dow LE, Ciccia A. Cell Rep. 2020 Mar 10;30(10):3280-3295.e6. doi: 10.1016/j.celrep.2020.02.068. 10.1016/j.celrep.2020.02.068 PubMed 32160537