Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

TBXTA-c025
(Plasmid #139762)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 139762 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pGTVL2 (GenBank: JF522100.1)
  • Backbone manufacturer
    SGC
  • Backbone size w/o insert (bp) 5993
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    TBXT, Full-length, G177D
  • Alt name
    Brachyury
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1341
  • Mutation
    G177D; contains only amino acids S2- M435
  • Entrez Gene
    TBXT (a.k.a. SAVA, T, TFT)
  • Promoter T7
  • Tag / Fusion Protein
    • His6-GST-TEV (N terminal on backbone)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer pGEX5: GGGCTGGCAAGCCACGTTTGGTG
  • 3′ sequencing primer T7R
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

S2- M435 : Codon-optimized for E. coli expression

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    TBXTA-c025 was a gift from Opher Gileadi (Addgene plasmid # 139762 ; http://n2t.net/addgene:139762 ; RRID:Addgene_139762)