pKM512
(Plasmid #140192)

• Purpose: For curing of Orbit-integrated plasmids and associated drug marker
• Depositing Lab: Kenan Murphy
• Publication: Murphy et al MBio. 2018 Dec 11;9(6). pii: mBio.01467-18. doi: 10.1128/mBio.01467-18.

Backbone

• Vector backbone: pKM461
• Backbone manufacturer: K. Murphy
• Backbone size w/o insert (bp): 816
• Total vector size (bp): 9906
• Modifications to backbone: Replaced RecT with gp47 Replaced kanamycin resistance gene with zeo resistance gene
• Vector type: Bacterial Expression
• Selectable markers: Zeocin ; Grow in LB containing 25 ug/mL zeocin.

Growth in Bacteria

• Bacterial Resistance(s): Bleocin (Zeocin), 25 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: zeocin resistance gene
• Insert Size (bp): 597
• Mutation: Kanamycin resistance gene in pKM461 replaced with zeocin resistance gene by recombineering
• Promoter: EM7

Cloning Information for Gene/Insert 1

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: CACAGGCCCGGTGTGAGAAGGGTC
• 3′ sequencing primer: CCGGTGAAGTCGTAGCATCGGTGA

Gene/Insert 2

• Gene/Insert name: Bxb1gp47 (directionality factor)
• Species: Mycobacterial phage Bxb1
• Insert Size (bp): 822
• Mutation: Cloned in gp47 directinality factor in place of RecT in pKM511 (a Zeo version of pKM461)
• Promoter: Ptet

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: NdeI (not destroyed)
• 3′ cloning site: KasI (not destroyed)
• 5′ sequencing primer: CACAGGCCCGGTGTGAGAAGGGTC
• 3′ sequencing primer: CCGGTGAAGTCGTAGCATCGGTGA

Resource Information

• A portion of this plasmid was derived from a plasmid made by: gp47 gene was received from Graham Hatfull

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

This plasmid can be used to removed ORBIT integrated plasmids leaving behind an Bxb1 attP site. After deletion of a target gene using ORBIT, the integrated plasmid (e.g., pKM464 - hygR) is excised by expressing phage Bxb1 Integrase and gp47 (directionality factor) from pKM512. A strain containing an ORBIT-generated deletion is transformed with pKM512 selecting for zeocin resistance. (This step cures the cell of pKM461 (kanR) used to make the deletion.) Select a zeoR colony containing pKM512 and grow to saturation in 7H10-zeocin. Dilute the culture 100-fold and regrow the strain in 7H10 without zeocin, but include 500 ng/ml anhydrotetracycline, (which induces expression of Integrase and gp47). Grow to saturation again, plate for single colonies, stab colonies on 7H10 plates containing 10% sucrose (Smeg) or 3% sucrose (Mtb) looking for hygromycin-sensitive colonies. Colonies should also be sensitive to kanamycin and zeocin. Once performed, the strain cannot be used for deletion of a second gene using ORBIT, as an attP site is now present at the site of the initial deletion.