Sender_plasmid2
(Plasmid #140693)

• Purpose: Encodes inducible expression of RhlI (C4-HSL quorum sensing synthase)
• Depositing Lab: Matthew Bennett
• Publication: Alnahhas et al ACS Synth Biol. 2019 Sep 20;8(9):2051-2058. doi: 10.1021/acssynbio.9b00146. Epub 2019 Aug 9.

Backbone

• Vector backbone: pMB1
• Backbone size w/o insert (bp): 3257
• Total vector size (bp): 3860
• Modifications to backbone: ROP element reduces copy number
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: RhlI
• Insert Size (bp): 603
• Entrez Gene: rhlI (a.k.a. PA3476)
• Promoter: engineered lac promoter (IPTG inducible)
• Tag / Fusion Protein:
  • ssrA degradation tag (ASV) (C terminal on backbone)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: tatggatgcggcgggac
• 3′ sequencing primer: gccagtgtgagacagcggtgcggac

Resource Information

• Supplemental Documents:
  • sender_plasmid2.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry