Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pEDJ-22
(Plasmid #140904)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 140904 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pCfB3035
  • Backbone size w/o insert (bp) 4300
  • Total vector size (bp) 5696
  • Modifications to backbone
    ADH1 promoter driving PCP-Mxi1 expression was inserted

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    PCP-Mxi1
  • Insert Size (bp)
    585
  • Promoter ADH1

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer gaaattcgcttatttagaagtgtc
  • 3′ sequencing primer CTCCTTCCTTTTCGGTTAGAG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEDJ-22 was a gift from Michael Jensen (Addgene plasmid # 140904 ; http://n2t.net/addgene:140904 ; RRID:Addgene_140904)
  • For your References section:

    Transcriptional reprogramming in yeast using dCas9 and combinatorial gRNA strategies. Jensen ED, Ferreira R, Jakociunas T, Arsovska D, Zhang J, Ding L, Smith JD, David F, Nielsen J, Jensen MK, Keasling JD. Microb Cell Fact. 2017 Mar 15;16(1):46. doi: 10.1186/s12934-017-0664-2. 10.1186/s12934-017-0664-2 PubMed 28298224