Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pGZ12.0501
(Plasmid #141164)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 141164 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pGH00.0126
  • Backbone manufacturer
    Guiltinan Lab
  • Backbone size w/o insert (bp) 16177
  • Total vector size (bp) 17041
  • Vector type
    Plant Expression
  • Selectable markers
    Kanamycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    TcTTC
  • Species
    Theobroma cacao
  • Insert Size (bp)
    864
  • GenBank ID
    KF871320
  • Promoter E12-omega

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SpeI (not destroyed)
  • 3′ cloning site HpaI (not destroyed)
  • 5′ sequencing primer ATGGGGAGGGCTCCTTGC
  • 3′ sequencing primer TTTGCCGAATCATTGCTCATCTAA
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Yufan Zhang, Graduate student

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Addgene NGS result had a single bp mismatch on the IS1 element and few discrepancies on the traF [KF871320] region. The depositor confirmed that these discrepancies do not affect the plasmid function.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGZ12.0501 was a gift from Mark Guiltinan (Addgene plasmid # 141164 ; http://n2t.net/addgene:141164 ; RRID:Addgene_141164)
  • For your References section:

    Enhanced somatic embryogenesis in Theobroma cacao using the homologous BABY BOOM transcription factor. Florez SL, Erwin RL, Maximova SN, Guiltinan MJ, Curtis WR. BMC Plant Biol. 2015 May 16;15:121. doi: 10.1186/s12870-015-0479-4. 10.1186/s12870-015-0479-4 PubMed 25976599