Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pXG289
(Plasmid #141283)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 141283 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    safe-harbor-expression
  • Backbone size w/o insert (bp) 4366
  • Total vector size (bp) 7882
  • Vector type
    Mammalian Expression
  • Selectable markers
    fluorescent

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    DELE1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    3516
  • Entrez Gene
    DELE1 (a.k.a. DELE, DELE1(L), KIAA0141)
  • Promoter EF1a
  • Tag / Fusion Protein
    • mClover

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site speI (not destroyed)
  • 3′ cloning site mluI (not destroyed)
  • 5′ sequencing primer cattatacgaagttattcgacattg
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pXG289 was a gift from Martin Kampmann (Addgene plasmid # 141283 ; http://n2t.net/addgene:141283 ; RRID:Addgene_141283)
  • For your References section:

    Mitochondrial stress is relayed to the cytosol by an OMA1-DELE1-HRI pathway. Guo X, Aviles G, Liu Y, Tian R, Unger BA, Lin YT, Wiita AP, Xu K, Correia MA, Kampmann M. Nature. 2020 Mar;579(7799):427-432. doi: 10.1038/s41586-020-2078-2. Epub 2020 Mar 4. 10.1038/s41586-020-2078-2 PubMed 32132707