-
Purpose3. Generation lentiviral vector expressing the codon optimized SARS-CoV2 Spike Glycoprotein ORF with a C-terminal HA tag generated by Junko Ogawa & Gerald M Pao
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 141347 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Lentiviral Prep | 141347-LV | Virus (1mL at titer ≥ 5x10⁵ TU/mL) and Plasmid. | $180 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepBOB-CAG
-
Backbone manufacturerVerma Lab (Salk Institute)
- Total vector size (bp) 13475
-
Vector typeLentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Growth instructionsdo not overgrow
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSARS-CoV2 Spike Glycoprotein
-
Alt nameSpike
-
Alt nameS
-
SpeciesSARS-CoV2 hCoV19_USA EPI_ISL_414366 (GISAID)
-
Insert Size (bp)3858
-
Mutationresynthesized with human codon optimization nucleotide sequence does not match original sequence.
-
Entrez GeneS (a.k.a. GU280_gp02, spike glycoprotein)
- Promoter CAG
-
Tag
/ Fusion Protein
- HA (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CAG-FWD AGCCTCTGCTAACCATGTTC
- 3′ sequencing primer WPRE-REV TCCTCCTCCTCTTGTGCTTC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Information for Lentiviral Prep (Catalog # 141347-LV) ( Back to top )
Purpose
Ready-to-use Lentiviral Prep particles produced from pBOB-CAG-SARS-CoV2-Spike-HA (#141347). In addition to the viral particles, you will also receive purified pBOB-CAG-SARS-CoV2-Spike-HA plasmid DNA.
Lentiviral particles carrying the SARS CoV2 spike glycoprotein with a C-terminal HA tag.Delivery
- Volume 1mL
- Titer ≥5x10⁵ TU/mL
- Pricing $150 USD for preparation of 1mL virus + $30 USD for plasmid.
- Storage Store at -80℃. Thaw just before use and keep on ice.
- Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.
Viral Production & Use
Biosafety
Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Viral Quality Control
- ddPCR assay: 293T cells were transduced with serial dilutions of 141347-LV, harvested several days later, and genomic DNA was isolated. Copies of RRE were measured and normalized to RPP30.
- PCR confirmation of insert: PCR was carried out with primers targeting the CoV2 spike gene and the WPRE element to confirm the backbone and the insert. The PCR product was visualized on an agarose gel for size confirmation.
Forward primer: COV2 Spike FP CGCCGCGACTAAAATGTCTG
Reverse primer: WPRE Rev CATAGCGTAAAAGGAGCAACA
Visit our viral production page for more information.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBOB-CAG-SARS-CoV2-Spike-HA was a gift from Gerald Pao (Addgene plasmid # 141347 ; http://n2t.net/addgene:141347 ; RRID:Addgene_141347)
For viral preps, please replace (Addgene plasmid # 141347) in the above sentence with: (Addgene viral prep # 141347-LV)
-
For your References section:
The D614G mutation in the SARS-CoV2 Spike protein increases infectivity in an ACE2 receptor dependent manner. Ogawa J, Zhu W, Tonnu N, Singer O, Hunter T, Ryan AL, Pao GM. bioRxiv. 2020 Jul 22. doi: 10.1101/2020.07.21.214932. 10.1101/2020.07.21.214932 PubMed 32743569