Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #141347)


Item Catalog # Description Quantity Price (USD)
Plasmid 141347 Standard format: Plasmid sent in bacteria as agar stab 1 $75
Lentiviral Prep 141347-LV Limited Stock Available, 2 units left
Virus (1mL at titer ≥ 5x10⁵ TU/mL) and Plasmid.

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
    Verma Lab (Salk Institute)
  • Total vector size (bp) 13475
  • Vector type

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
    NEB Stable
  • Growth instructions
    do not overgrow
  • Copy number
    High Copy


  • Gene/Insert name
    SARS-CoV2 Spike Glycoprotein
  • Alt name
  • Alt name
  • Species
    SARS-CoV2 hCoV19_USA EPI_ISL_414366 (GISAID)
  • Insert Size (bp)
  • Mutation
    resynthesized with human codon optimization nucleotide sequence does not match original sequence.
  • Entrez Gene
    S (a.k.a. GU280_gp02, spike glycoprotein)
  • Promoter CAG
  • Tag / Fusion Protein
    • HA (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CAG-FWD AGCCTCTGCTAACCATGTTC
  • 3′ sequencing primer WPRE-REV TCCTCCTCCTCTTGTGCTTC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
  • Zeocin® is an InvivoGen trademark.

Information for Lentiviral Prep (Catalog # 141347-LV) ( Back to top )


Ready-to-use Lentiviral Prep particles produced from pBOB-CAG-SARS-CoV2-Spike-HA (#141347). In addition to the viral particles, you will also receive purified pBOB-CAG-SARS-CoV2-Spike-HA plasmid DNA.

Lentiviral particles carrying the SARS CoV2 spike glycoprotein with a C-terminal HA tag.


  • Volume 1mL
  • Titer ≥5x10⁵ TU/mL
  • Pricing $100 USD for preparation of 1mL virus + $30 USD for plasmid.
  • Storage Store at -80℃. Thaw just before use and keep on ice.
  • Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

  • Packaging Plasmids psPAX2 (plasmid #12260)
  • Envelope pMD2.G (plasmid #12259)
  • Buffer OptiPro


Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Terms and Licenses

Viral Quality Control

Titering Method:
  • ddPCR assay: 293T cells were transduced with serial dilutions of 141347-LV, harvested several days later, and genomic DNA was isolated. Copies of RRE were measured and normalized to RPP30.
  • PCR confirmation of insert: PCR was carried out on the viral preparation with primers targeting the CoV2 spike gene and WPRE to confirm the backbone and the insert. The PCR product was visualized on an agarose gel for size confirmation.

Visit our viral production page for more information.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBOB-CAG-SARS-CoV2-Spike-HA was a gift from Gerald Pao (Addgene plasmid # 141347 ; ; RRID:Addgene_141347)

    For viral preps, please replace (Addgene plasmid # 141347) in the above sentence with: (Addgene viral prep # 141347-LV)

  • For your References section:

    The D614G mutation in the SARS-CoV2 Spike protein increases infectivity in an ACE2 receptor dependent manner. Ogawa J, Zhu W, Tonnu N, Singer O, Hunter T, Ryan AL, Pao GM. bioRxiv. 2020 Jul 22. doi: 10.1101/2020.07.21.214932. 10.1101/2020.07.21.214932 PubMed 32743569