pF3-CAG-Tol-FRT
(Plasmid
#141349)
-
PurposeShuttling cassette containing the Tol ORF
-
Depositing Lab
-
Depositing OrganizationNetherlands Cancer Institute
Located in Netherlands -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 141349 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepF3-FRT
- Backbone size w/o insert (bp) 4000
- Total vector size (bp) 11400
-
Vector typeMammalian Expression, Mouse Targeting
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameTol cassette
-
SpeciesSynthetic
-
Insert Size (bp)7300
- Promoter CAG
-
Tag
/ Fusion Protein
- HA (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer gtgctgtctcatcattttgg
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pF3-CAG-Tol-FRT was a gift from Ton Schumacher (Addgene plasmid # 141349 ; http://n2t.net/addgene:141349 ; RRID:Addgene_141349) -
For your References section:
A mouse model that is immunologically tolerant to reporter and modifier proteins. Bresser K, Dijkgraaf FE, Pritchard CEJ, Huijbers IJ, Song JY, Rohr JC, Scheeren FA, Schumacher TN. Commun Biol. 2020 May 29;3(1):273. doi: 10.1038/s42003-020-0979-0. 10.1038/s42003-020-0979-0 PubMed 32472011