pYL156 (TRV RNA2)
(Plasmid #148969)

• Purpose: Modified Tobacco Rattle Virus RNA 2; used for virus induced gene silencing in plants along with pYL192 (TRV RNA1)
• Depositing Lab: Savithramma Dinesh-Kumar
• Publication: Liu et al Plant J. 2002 May;30(4):415-29. doi: 10.1046/j.1365-313x.2002.01297.x.

Backbone

• Vector backbone: pCAMBIA0390 T-DNA vector
• Backbone size w/o insert (bp): 6426
• Total vector size (bp): 9663
• Vector type: T-DNA vector
• Selectable markers: Kanamycin

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: We prefer to use DH10B cells
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Modified TRV RNA2
• Species: Modified Tobacco Rattle Virus RNA 2
• Insert Size (bp): 2106
• Mutation: see comments section below
• GenBank ID: AF406991

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI, XbaI, StuI, NcoI, BamHI, KpnI, SacI, MluI, XhoI, XmaI (unknown if destroyed)
• 3′ cloning site: None (unknown if destroyed)
• 5′ sequencing primer: TGTTACTCAAGGAAGCACGATGAGCT

Resource Information

• Supplemental Documents:
  • TRV1 and TRV2 VIGS vectors papers
• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

There are a few differences between the Addgene full sequence and the Genbank ID: AF406991. These discrepancies were confirmed to not cause functional differences:
- 1 bp insertion (T3313) in backbone.
- 1 bp mismatch (T5593C) and 1 bp insertion (G5646) in pVS1 RepA (known variant).
- IS4-like element inserted between ori and KanR (1338bp insert at positions 8295-9632bp).