Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pDONR207 SARS-CoV-2 M_nostop
(Plasmid #149322)


Item Catalog # Description Quantity Price (USD)
Plasmid 149322 Standard format: Plasmid sent in bacteria as agar stab 1 $75 *

* Login to view industry pricing.


  • Vector backbone
  • Backbone manufacturer
  • Backbone size w/o insert (bp) 5585
  • Vector type
    Gateway-compatible Entry vector

Growth in Bacteria

  • Bacterial Resistance(s)
    Gentamycin, 10 μg/mL
  • Growth Temperature
  • Growth Strain(s)
  • Copy number


  • Gene/Insert name
  • Species
    SARS-CoV-2 isolate Wuhan-Hu-1
  • Insert Size (bp)
  • Mutation
    Many synonymous changes due to codon optimization
  • Entrez Gene
    M (a.k.a. GU280_gp05)

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer TCGCGTTAACGCTAGCATGGATCT
  • 3′ sequencing primer GTAACATCAGAGATTTTGAGACAC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Synthesized from GenScript

Terms and Licenses

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pDONR207 SARS-CoV-2 M_nostop was a gift from Fritz Roth (Addgene plasmid # 149322 ; ; RRID:Addgene_149322)
  • For your References section:

    A Comprehensive, Flexible Collection of SARS-CoV-2 Coding Regions. Kim DK, Knapp JJ, Kuang D, Chawla A, Cassonnet P, Lee H, Sheykhkarimli D, Samavarchi-Tehrani P, Abdouni H, Rayhan A, Li R, Pogoutse O, Coyaud E, van der Werf S, Demeret C, Gingras AC, Taipale M, Raught B, Jacob Y, Roth FP. G3 (Bethesda). 2020 Aug 6. pii: g3.120.401554. doi: 10.1534/g3.120.401554. 10.1534/g3.120.401554 PubMed 32763951