EC71167
(Plasmid #154066)

• Purpose: Level 1 Position 3 Golden Gate vector, pL1M-R3-UbqP-Loxp-ER-Targ-mCherry-HDEL-Loxp-eGFP
• Depositing Lab: Cristobal Uauy
• Publication: Harrington et al Plant Methods. 2020 Oct 14;16:137. doi: 10.1186/s13007-020-00677-3. eCollection 2020.

Backbone

• Vector backbone: EC47822
• Backbone manufacturer: ENSA
• Backbone size w/o insert (bp): 4376
• Total vector size (bp): 8790
• Vector type: Synthetic Biology

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: ZmUBI::lox-mCHERRY-lox-T35S-eGFP-TAct
• Alt name: Lox bound mCHERRY
• Species: A. thaliana (mustard weed), Synthetic; Zea mays
• Insert Size (bp): 4414
• Mutation: All BsaI, Esp3I and BPiI restriction sites were removed using synonymous changes
• Promoter: Zea mays Ubiquitin Promoter

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BsaI (destroyed during cloning)
• 3′ cloning site: BsaI (destroyed during cloning)
• 5′ sequencing primer: GCACATACAAATGGACGAAC
• 3′ sequencing primer: CTGCCTGTATCGAGTGGTGA

Resource Information

• Supplemental Documents:
  • ec71167-pl1m-r3-.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry