EC71174
(Plasmid #154067)

• Purpose: Level 2 Golden Gate vector, pL2M-HvHSP17-CREU5-UBQ-loxmCHERRYER-eGFPER
• Depositing Lab: Cristobal Uauy
• Publication: Harrington et al Plant Methods. 2020 Oct 14;16:137. doi: 10.1186/s13007-020-00677-3. eCollection 2020.

Backbone

• Vector backbone: EC15027
• Backbone manufacturer: ENSA
• Backbone size w/o insert (bp): 4834
• Total vector size (bp): 13415
• Vector type: Bacterial Expression, Plant Expression, Cre/Lox, Synthetic Biology ; Golden Gate
• Selectable markers: Hygromycin

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: HS Cre recombinase
• Alt name: HS::CRE
• Species: A. thaliana (mustard weed), Synthetic; Enterobacteria Phage P1, Hordeum vulgare heat shock promoter from pHSPdGUS (Freeman et al 2011, Plant Biotech Journal)
• Insert Size (bp): 2134
• Mutation: The Arabidopsis thaliana U5 small nuclear ribonucleoprotein component intron from pICSL80006 (TSL SynBio) is inserted at 254bp in the Cre recombinase. BsaI, Esp3I and BpiI restriction sites were removed using synonymous changes.
• GenBank ID: NM_2777477
• Promoter: Hordeum vulgare HSP 17 promoter used in Freeman et al 2011 Plant Biotechnology Journal pHSPdGUS

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: BpiI (destroyed during cloning)
• 3′ cloning site: BpiI (destroyed during cloning)
• 5′ sequencing primer: GATGGTGCATGGACCACCCGGA
• 3′ sequencing primer: ACCAGAGTGTCGTGCTCCACCA

Gene/Insert 2

• Gene/Insert name: Ubiquitin promoter driving mCherry with the 35S terminator, flanked by lox sites, followed by eGFP with the Actin terminator
• Alt name: ZmUbi::lox-mCHERRY-T35S-lox-eGFP-TAct
• Species: A. thaliana (mustard weed), Synthetic; Hordeum vulgare (heat shock promoter), Zea mays (Ubiquitin promoter)
• Insert Size (bp): 4414
• Promoter: Zea mays Ubiquitin promoter with intron

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: BpiI (destroyed during cloning)
• 3′ cloning site: BpiI (destroyed during cloning)
• 5′ sequencing primer: GCACATACAAATGGACGAAC
• 3′ sequencing primer: ACCCAGAGAGTTTGTCACACACA

Gene/Insert 3

• Gene/Insert name: HYGROMYCIN Resistance Cassette
• Alt name: HYG
• Alt name: HPT
• Alt name: 35S promoter driving HYG resistance gene with the NOS terminator
• Species: Synthetic
• Insert Size (bp): 1909
• Promoter: 35S promoter

Cloning Information for Gene/Insert 3

• Cloning method: Restriction Enzyme
• 5′ cloning site: BpiI (destroyed during cloning)
• 3′ cloning site: BpiI (destroyed during cloning)
• 5′ sequencing primer: TAACATAGATGACACCGCGCGCG
• 3′ sequencing primer: TGGTGGAGCACGACACTCTGGT

Resource Information

• Supplemental Documents:
  • ec71174-pl2m.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry