Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pCMV(Δ3)-squirrel-monkey-full-length-CHMP3-HA
(Plasmid #154169)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 154169 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pCMV(delta3)
  • Backbone manufacturer
    DNASU EvNO00601605
  • Backbone size w/o insert (bp) 5027
  • Total vector size (bp) 5700
  • Modifications to backbone
    deletion mutant of the CMV promoter for attenuated expression
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    CHMP3
  • Species
    S. sciureus (squirrel monkey)
  • Insert Size (bp)
    696
  • Promoter CMV
  • Tag / Fusion Protein
    • HA (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site ApaI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer GGGAACGGAAAGCCGGAAGGAGCAAGAC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCMV(Δ3)-squirrel-monkey-full-length-CHMP3-HA was a gift from Wesley Sundquist (Addgene plasmid # 154169 ; http://n2t.net/addgene:154169 ; RRID:Addgene_154169)
  • For your References section:

    RetroCHMP3 blocks budding of enveloped viruses without blocking cytokinesis. Rheinemann L, Downhour DM, Bredbenner K, Mercenne G, Davenport KA, Schmitt PT, Necessary CR, McCullough J, Schmitt AP, Simon SM, Sundquist WI, Elde NC. Cell. 2021 Sep 27. pii: S0092-8674(21)01055-2. doi: 10.1016/j.cell.2021.09.008. 10.1016/j.cell.2021.09.008 PubMed 34597582