pCAG-OSF-PP-human-CHMP3(150)
(Plasmid
#154181)
-
Purposeexpresses human CHMP3(150) in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 154181 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepCAG-OSF-PP
-
Backbone manufacturerAddgene 154247
- Backbone size w/o insert (bp) 5016
- Total vector size (bp) 5459
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCHMP3
-
SpeciesH. sapiens (human)
-
Insert Size (bp)841
-
MutationC-terminal truncation of CHMP3 at amino acid 150
- Promoter CAG
-
Tags
/ Fusion Proteins
- Strep-Tag II (N terminal on backbone)
- FLAG (N terminal on backbone)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TCGGCTTCTGGCGTGTGACC
- 3′ sequencing primer TGTCCCCATAATTTTTGGCAGAGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCAG-OSF-PP-human-CHMP3(150) was a gift from Wesley Sundquist (Addgene plasmid # 154181 ; http://n2t.net/addgene:154181 ; RRID:Addgene_154181) -
For your References section:
RetroCHMP3 blocks budding of enveloped viruses without blocking cytokinesis. Rheinemann L, Downhour DM, Bredbenner K, Mercenne G, Davenport KA, Schmitt PT, Necessary CR, McCullough J, Schmitt AP, Simon SM, Sundquist WI, Elde NC. Cell. 2021 Sep 27. pii: S0092-8674(21)01055-2. doi: 10.1016/j.cell.2021.09.008. 10.1016/j.cell.2021.09.008 PubMed 34597582