pDYU1G/mRuby3–histone H1; γ-tubulin-mEGFP
(Plasmid
#154303)
-
PurposeExpresses mRuby3–histone H1 and γ-tubulin-mEGFP from actin15 promoter in Dictyostelium discoideum
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 154303 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepDYU1G
-
Backbone manufacturerTomo Kondo
- Backbone size w/o insert (bp) 7697
- Total vector size (bp) 11632
-
Vector typeDictyostelium Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert namehistone H1
-
SpeciesDictyostelium discoideum
- Promoter actin15
-
Tag
/ Fusion Protein
- mRuby3 (N terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer GATCTATGGGTCCAAAAGC (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameγ-tubulin
-
SpeciesDictyostelium discoideum
- Promoter actin15
-
Tag
/ Fusion Protein
- mEGFP (C terminal on insert)
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site BglII (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer GGGTCTAGAGATCTATGCCAAGAGAAATAATTACT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDYU1G/mRuby3–histone H1; γ-tubulin-mEGFP was a gift from Shigehiko Yumura (Addgene plasmid # 154303 ; http://n2t.net/addgene:154303 ; RRID:Addgene_154303) -
For your References section:
An improved molecular tool for screening bacterial colonies using GFP expression enhanced by a Dictyostelium sequence. Kondo T, Yumura S. Biotechniques. 2020 Feb;68(2):91-95. doi: 10.2144/btn-2019-0127. Epub 2019 Dec 11. 10.2144/btn-2019-0127 PubMed 31825246