Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pHR-UCOE-SFFV-dCas9-mCherry-ZIM3-KRAB
(Plasmid #154473)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 154473 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pHR-SFFV-dCas9-BFP-KRAB
  • Backbone manufacturer
    Jonathan Weissman lab (Addgene plasmid #46911)
  • Total vector size (bp) 14812
  • Modifications to backbone
    Replaced BFP with mCherry and KOX1 KRAB domain with ZIM3 KRAB domain
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    mCherry (fused to dCas9)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Growth instructions
    Grow at 30 degrees to avoid recombination
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ZIM3
  • Species
    H. sapiens (human)
  • Mutation
    Includes ZIM3 aa 1-100
  • Entrez Gene
    ZIM3 (a.k.a. ZNF264, ZNF657)
  • Promoter SFFV
  • Tag / Fusion Protein
    • HA (N terminal on backbone)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ATTGATTGACTGCCCACCTC
  • 3′ sequencing primer CATAGCGTAAAAGGAGCAACA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pHR-UCOE-SFFV-dCas9-mCherry-ZIM3-KRAB was a gift from Mikko Taipale (Addgene plasmid # 154473 ; http://n2t.net/addgene:154473 ; RRID:Addgene_154473)
  • For your References section:

    An efficient KRAB domain for CRISPRi applications in human cells. Alerasool N, Segal D, Lee H, Taipale M. Nat Methods. 2020 Nov;17(11):1093-1096. doi: 10.1038/s41592-020-0966-x. Epub 2020 Oct 5. 10.1038/s41592-020-0966-x PubMed 33020655