Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pAAV-hSyn-fDIO-rM3D(Gs)-mCherry-WPREpA
(Plasmid #154869)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 154869 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pAAV-hSyn-Flp-WPRE
  • Backbone manufacturer
    Gether lab - modified from Addgene plasmid #55641
  • Backbone size w/o insert (bp) 4824
  • Total vector size (bp) 6792
  • Vector type
    Mammalian Expression, AAV ; FLP-FRT

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    rM3D(Gs)-mCherry
  • Alt name
    Gs-DREADD
  • Insert Size (bp)
    1968
  • Promoter Human Synapsin-1
  • Tag / Fusion Protein
    • mCherry (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Asc1 (not destroyed)
  • 3′ cloning site Nhe1 (not destroyed)
  • 5′ sequencing primer actcagcgctgcctcagtct
  • 3′ sequencing primer gatacaaaggcattaaagcagcg
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    The insert is derived from Addgene #50458 and the backbone is modified (Ef1a promoter replaced with human synapsin promoter Addgene # Plasmid #55641).

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-hSyn-fDIO-rM3D(Gs)-mCherry-WPREpA was a gift from Ulrik Gether (Addgene plasmid # 154869 ; http://n2t.net/addgene:154869 ; RRID:Addgene_154869)