Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

3xFLAG-CUL7-pCMV7.1
(Plasmid #155025)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 155025 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pCMV7.1
  • Backbone size w/o insert (bp) 4717
  • Total vector size (bp) 10244
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Cullin 7
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    5527
  • GenBank ID
    BC033647.1
  • Entrez Gene
    CUL7 (a.k.a. 3M1, CUL-7, KIAA0076, dJ20C7.5)
  • Promoter pCMV7.1
  • Tag / Fusion Protein
    • 3xFLAG (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NotI (unknown if destroyed)
  • 3′ cloning site KpnI (unknown if destroyed)
  • 5′ sequencing primer AATGTCGTAATAACCCCGCCCCGTTGACGC
  • 3′ sequencing primer CCTAGTCAGACAAAATGATGC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    3xFLAG-CUL7-pCMV7.1 was a gift from Andre Catic (Addgene plasmid # 155025 ; http://n2t.net/addgene:155025 ; RRID:Addgene_155025)
  • For your References section:

    The ubiquitin ligase Cullin-1 associates with chromatin and regulates transcription of specific c-MYC target genes. Sweeney MA, Iakova P, Maneix L, Shih FY, Cho HE, Sahin E, Catic A. Sci Rep. 2020 Aug 18;10(1):13942. doi: 10.1038/s41598-020-70610-0. 10.1038/s41598-020-70610-0 PubMed 32811853