Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

Cas9 ROSA sgRNA mCherry
(Plasmid #155280)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 155280 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    Addgene #99154
  • Modifications to backbone
    Insert ROSA sgRNA at BsmB1 sites. Sequence of sgRNA is GAAGATGGGCGGGAGTCTTC with appropriate overhangs. To be used with reporter constructs 155282 and 155283

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    spCas9

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Cas9 ROSA sgRNA mCherry was a gift from Martin Carroll (Addgene plasmid # 155280 ; http://n2t.net/addgene:155280 ; RRID:Addgene_155280)