Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

Lenti sgRNA NGFR GFP out of frame
(Plasmid #155282)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 155282 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    Addgene #108098
  • Modifications to backbone
    GFP modified so that ATG is followed by GAAGATGGGCGGGAGTCTTC and PAM site. Attached to IRES-NGFR. GFP sequence modified to add stop in alternative GFP frame (GFP protein sequence retained). Allows tracking of edited cells by ROSA sgRNA. Used with 155280

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    GFP out of frame IRES NGFR
  • gRNA/shRNA sequence
    empty

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Lenti sgRNA NGFR GFP out of frame was a gift from Martin Carroll (Addgene plasmid # 155282 ; http://n2t.net/addgene:155282 ; RRID:Addgene_155282)