Skip to main content
Addgene
Open Menu

pRetroSuper C/EBP beta
(Plasmid #15719)

Print

Full plasmid sequence is not available for this item.

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 15719 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pRetrosuper
  • Backbone size w/o insert (bp) 6400
  • Vector type
    Mammalian Expression, Retroviral, RNAi
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    C/EBP beta shRNA
  • Alt name
    C/EBP beta
  • Alt name
    C/EBPb
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    64
  • Entrez Gene
    CEBPB (a.k.a. C/EBP-beta, IL6DBP, NF-IL6, TCF5)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BglII (unknown if destroyed)
  • 3′ cloning site HindIII (unknown if destroyed)
  • 5′ sequencing primer H1
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The pRetrosuper sh(C/EBPβ) vector was generated by digesting pRetrosuper with BglII and HindIII and ligating with annealed oligos. The siRNA oligo pairs targeting C/EBPβ were 5′GATCCCCATCCATGGAAGTGGCCAAC TTCAAGAGAGTTGGCCACTTCCATGGATTTTTTGGAA - 3'. The target sequence was ATCCATGGAAGTGGCCAAC.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pRetroSuper C/EBP beta was a gift from Joan Massague (Addgene plasmid # 15719)

  • For your References section:

    C/EBPbeta at the core of the TGFbeta cytostatic response and its evasion in metastatic breast cancer cells. Gomis RR, Alarcon C, Nadal C, Van Poznak C, Massague J. Cancer Cell. 2006 Sep . 10(3):203-14. 10.1016/j.ccr.2006.07.019 PubMed 16959612
Related items: