Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

61426-hU6-shmFmr1-EF1a-mCherry
(Plasmid #157859)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 157859 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    Addgene #61426
  • Backbone size w/o insert (bp) 11736
  • Total vector size (bp) 10239
  • Modifications to backbone
    replacing inserts with shRNA-EF1a-mCherry
  • Vector type
    Mammalian Expression, Lentiviral, RNAi

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Fmr1
  • gRNA/shRNA sequence
    cgcaccaagttgtctcttata
  • Species
    M. musculus (mouse)
  • Entrez Gene
    Fmr1 (a.k.a. FMRP, Fmr-1)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    61426-hU6-shmFmr1-EF1a-mCherry was a gift from Xinyu Zhao (Addgene plasmid # 157859 ; http://n2t.net/addgene:157859 ; RRID:Addgene_157859)
  • For your References section:

    Reduced mitochondrial fusion and Huntingtin levels contribute to impaired dendritic maturation and behavioral deficits in Fmr1-mutant mice. Shen M, Wang F, Li M, Sah N, Stockton ME, Tidei JJ, Gao Y, Korabelnikov T, Kannan S, Vevea JD, Chapman ER, Bhattacharyya A, van Praag H, Zhao X. Nat Neurosci. 2019 Mar;22(3):386-400. doi: 10.1038/s41593-019-0338-y. Epub 2019 Feb 11. 10.1038/s41593-019-0338-y PubMed 30742117