Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pMSCV-puro-mycRSK2wt
(Plasmid #15827)

Loading...

Full plasmid sequence is not available for this item.

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 15827 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pMSCV-puro-gateway
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 6391
  • Vector type
    Mammalian Expression, Retroviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    LB broth
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Ribosomal S6 kinase 2
  • Alt name
    RSK2
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    2253
  • Mutation
    wild type
  • GenBank ID
    AY083469
  • Entrez Gene
    Rps6ka3 (a.k.a. MAPKAPK-1b, MPK-9, Rs, Rsk2, S6K-alpha3, p90RSK3, pp90RSK2)
  • Tag / Fusion Protein
    • myc (N terminal on insert)

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ cloning site Gateway1 (not destroyed)
  • 3′ cloning site Gateway2 (not destroyed)
  • 5′ sequencing primer CCCTGGAACCTCCTCGTTCGACC
  • 3′ sequencing primer GAGACGTGCTACTTCCATTTGTC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Template pKH3-RSK2 was obtained from Morten Frodin in Department of Clinical Biochemistry, Glostrup Hospital, Denmark.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMSCV-puro-mycRSK2wt was a gift from Jing Chen (Addgene plasmid # 15827 ; http://n2t.net/addgene:15827 ; RRID:Addgene_15827)
  • For your References section:

    FGFR3 Activates RSK2 to Mediate Hematopoietic Transformation through Tyrosine Phosphorylation of RSK2 and Activation of the MEK/ERK Pathway. Kang S, Dong S, Gu TL, Guo A, Cohen MS, Lonial S, Khoury HJ, Fabbro D, Gilliland DG, Bergsagel PL, Taunton J, Polakiewicz RD, Chen J. Cancer Cell. 2007 Sep . 12(3):201-14. 10.1016/j.ccr.2007.08.003 PubMed 17785202