Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pX330_gRNA_IG-DMR-1
(Plasmid #159931)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 159931 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pX330-U6-Chimeric_BB-CBh-hSpCas9
  • Backbone manufacturer
    Addgene 42230
  • Backbone size w/o insert (bp) 8506
  • Vector type
    Mammalian Expression, Mouse Targeting, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    gRNA mouse IG-DMR
  • Alt name
    Gtl2-Dlk1 intergenic germline-derived differentially methylated region
  • gRNA/shRNA sequence
    CGTACAGAGCTCCATGGCAC
  • Species
    M. musculus (mouse)
  • GenBank ID
    AC107681
  • Promoter U6, CBh

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BbsI (destroyed during cloning)
  • 3′ cloning site BbsI (destroyed during cloning)
  • 5′ sequencing primer GAGGGCCTATTTCCCATGATTCC
  • 3′ sequencing primer AAAAAAGCACCGACTCGGTGCC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pX330_gRNA_IG-DMR-1 was a gift from Anton Wutz (Addgene plasmid # 159931 ; http://n2t.net/addgene:159931 ; RRID:Addgene_159931)
  • For your References section:

    Polyploidy of semi-cloned embryos generated from parthenogenetic haploid embryonic stem cells. Aizawa E, Dumeau CE, Freimann R, Di Minin G, Wutz A. PLoS One. 2020 Sep 10;15(9):e0233072. doi: 10.1371/journal.pone.0233072. eCollection 2020. 10.1371/journal.pone.0233072 PubMed 32911495