pPaGE Pyl TAG FliC T248TAG
(Plasmid #160089)

• Purpose: Encodes for MmPyl tRNA synthetase/tRNA pair and for flagellin protein (FliC) with TAG mutation at site 248, for unnatural amino acid incorporation into the flagellin protein in Pseudomonas aeruginosa.
• Depositing Lab: Lital Alfonta
• Publication: Ozer et al Sci Adv. 2021 Jun 11;7(24). pii: 7/24/eabg8581. doi: 10.1126/sciadv.abg8581. Print 2021 Jun.

Backbone

• Vector backbone: pMRP9-1
• Backbone size w/o insert (bp): 4756
• Total vector size (bp): 8660
• Modifications to backbone: Remains of partial URA3 gene for selection in yeast from previous yeast assembly, however no longer contains the full sequence for the procedure and only pMRP9-1 origins and selection remained.
• Vector type: Bacterial Expression, Synthetic Biology

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert 1

• Gene/Insert name: Pyrrolysyl tRNA(cua) (Methanosarcina mazei)
• Alt name: MmPyl-tRNA
• Species: Methanosarcina mazei
• Insert Size (bp): 72
• Promoter: Pseudomonas aeruginosa Leu-tRNA native promoter and terminator

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: TAACCCAGATGCCGCTGGATC
• 3′ sequencing primer: ACGCTAAGCTTGCCCTATGG

Gene/Insert 2

• Gene/Insert name: Pyrrolysyl tRNA synthetase (Methanosarcina mazei)
• Alt name: MmPylRS
• Species: Methanosarcina mazei
• Insert Size (bp): 1365
• Promoter: Pseudomonas aeruginosa LeuRS native promoter and terminator

Cloning Information for Gene/Insert 2

• Cloning method: Gibson Cloning
• 5′ sequencing primer: ACCCAAGTCGATGAGCGATC
• 3′ sequencing primer: AACAGGGCACGCCGGGCATG

Gene/Insert 3

• Gene/Insert name: Flagellin
• Alt name: FliC
• Species: Pseudomonas aeruginosa
• Insert Size (bp): 1467
• Mutation: Changed Threonine 248 to TAG stop-codon.
• Promoter: Pseudomonas aeruginosa fliC native promoter and terminator

Cloning Information for Gene/Insert 3

• Cloning method: Gibson Cloning
• 5′ sequencing primer: ACAGGAGTGAGGGAAGCTTG
• 3′ sequencing primer: GCGGATAATGCCTTTAGCGG

Resource Information

• Supplemental Documents:
  • pPaGE Pyl TAG FliC T248TAG.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry