pRK5-3(β2)
(Plasmid
#160268)
-
PurposeExpresses a concatemeric construct of a α4:β2 (2:3) nAChR
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 160268 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepKR5
- Backbone size w/o insert (bp) 4668
- Total vector size (bp) 12970
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert name3(β2) concatemer
-
Alt nameα4-β2-α4-β2-β2 concatemer
-
SpeciesH. sapiens (human)
-
Insert Size (bp)8208
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site ClaI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer GCCTTTCTCTCCACAGGTGTCC
- 3′ sequencing primer GTGAAATTTGTGATGCTATTG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRK5-3(β2) was a gift from Pierre-Jean Corringer (Addgene plasmid # 160268 ; http://n2t.net/addgene:160268 ; RRID:Addgene_160268) -
For your References section:
Concatemers to re-investigate the role of alpha5 in alpha4beta2 nicotinic receptors. Prevost MS, Bouchenaki H, Barilone N, Gielen M, Corringer PJ. Cell Mol Life Sci. 2020 May 29. pii: 10.1007/s00018-020-03558-z. doi: 10.1007/s00018-020-03558-z. 10.1007/s00018-020-03558-z PubMed 32472188