Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pMJB1-RPL1B-Cl
(Plasmid #160430)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 160430 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pMJB1
  • Backbone size w/o insert (bp) 6401
  • Total vector size (bp) 7052
  • Vector type
    Yeast Expression
  • Selectable markers
    URA3

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    RPL1B
  • Species
    S. cerevisiae (budding yeast)
  • Insert Size (bp)
    651
  • Mutation
    Removed introns, shuffled codons to vary nucleotide sequence but maintain amino acid sequence
  • GenBank ID
    NC_001139.9
  • Promoter S. cerevisiae GAL1
  • Tag / Fusion Protein
    • mCherry (C terminal on backbone)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CTTTAACGTCAAGGAGAAGGTT
  • 3′ sequencing primer TGATGATGGCCATGTTATCC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMJB1-RPL1B-Cl was a gift from Gary Stormo (Addgene plasmid # 160430 ; http://n2t.net/addgene:160430 ; RRID:Addgene_160430)
  • For your References section:

    Autoregulation of yeast ribosomal proteins discovered by efficient search for feedback regulation. Roy B, Granas D, Bragg F Jr, Cher JAY, White MA, Stormo GD. Commun Biol. 2020 Dec 11;3(1):761. doi: 10.1038/s42003-020-01494-z. 10.1038/s42003-020-01494-z PubMed 33311538