pLNL1134
(Plasmid #160865)

• Purpose: PJ23110-RBS-ScEHT1-mRuby2-tL3S2P24_KanR_p15A
• Depositing Lab: John Dueber
• Publication: Latimer et al ACS Synth Biol. 2020 Sep 18. doi: 10.1021/acssynbio.0c00297.

Backbone

• Vector backbone: p15A
• Total vector size (bp): 4427
• Vector type: Bacterial Expression, Synthetic Biology

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: Medium-chain fatty acid ethyl ester synthase
• Alt name: EHT1
• Species: S. cerevisiae (budding yeast)
• Insert Size (bp): 2197
• Promoter: PJ23110
• Tag / Fusion Protein:
  • mRuby2 (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BsaI (destroyed during cloning)
• 3′ cloning site: BsaI (destroyed during cloning)
• 5′ sequencing primer: accatctgaatcatgcgcgg
• 3′ sequencing primer: ctggttccggctgtcttgc

Resource Information

• Supplemental Documents:
  • pLNL1134.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry