pEF-ManII-GFP
(Plasmid
#160905)
-
PurposeExpresses the Golgi marker ManII-GFP in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 160905 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepEF/myc/ER
- Backbone size w/o insert (bp) 5300
- Total vector size (bp) 9600
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameMAN2A1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)4176
-
GenBank ID4124
-
Entrez GeneMAN2A1 (a.k.a. AMan II, GOLIM7, MANA2, MANII)
- Promoter EF-1a
-
Tag
/ Fusion Protein
- GFP (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GGCACTTGATGTAATTCTCCTTGGAATT
- 3′ sequencing primer cctgctattgtcttcccaatcctcc (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEF-ManII-GFP was a gift from Benjamin Glick (Addgene plasmid # 160905 ; http://n2t.net/addgene:160905 ; RRID:Addgene_160905) -
For your References section:
ESCargo: a regulatable fluorescent secretory cargo for diverse model organisms. Casler JC, Zajac AL, Valbuena FM, Sparvoli D, Jeyifous O, Turkewitz AP, Horne-Badovinac S, Green WN, Glick BS. Mol Biol Cell. 2020 Oct 28:mbcE20090591. doi: 10.1091/mbc.E20-09-0591. 10.1091/mbc.E20-09-0591 PubMed 33112725