plIVMD163
(Plasmid
#160935)
-
PurposeIn vivo mRNA display construct for mCherry
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 160935 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneplIVMD156
- Backbone size w/o insert (bp) 6000
- Total vector size (bp) 7700
-
Vector typeYeast Expression
-
Selectable markersURA3
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameMCP-mCherry-HIS tag, 3'UTR MS2 Stem Loop
-
Alt nameMS2 coat protein, MS2 hairpin
-
SpeciesS. cerevisiae (budding yeast)
- Promoter MET25
-
Tag
/ Fusion Protein
- HIS tag, 3'UTR MS2 Stem Loop
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer TAGATACAATTCTATTACCCCCATCCATACTCT
- 3′ sequencing primer GTAAGCGTGACATAACTAATTACATGACTCGAG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
plIVMD163 was a gift from Saeed Tavazoie (Addgene plasmid # 160935 ; http://n2t.net/addgene:160935 ; RRID:Addgene_160935) -
For your References section:
In vivo mRNA display enables large-scale proteomics by next generation sequencing. Oikonomou P, Salatino R, Tavazoie S. Proc Natl Acad Sci U S A. 2020 Oct 9. pii: 2002650117. doi: 10.1073/pnas.2002650117. 10.1073/pnas.2002650117 PubMed 33037152