Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #160944)


Item Catalog # Description Quantity Price (USD)
Plasmid 160944 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
    Addgene 21654
  • Backbone size w/o insert (bp) 7656
  • Total vector size (bp) 9456
  • Vector type
    Mammalian Expression, Retroviral
  • Selectable markers

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy


  • Gene/Insert name
  • Species
    M. musculus (mouse)
  • Mutation
    Deletion of Zinc finger 2 (C306 to C330)
  • Entrez Gene
    Nr4a1 (a.k.a. GFR, GFRP1, Gf, Gfrp, Hbr, Hbr-, Hbr-1, Hbr1, Hm, Hmr, N1, N10, NGFI, NGFI-B, NGFIB, NP, NP10, NUR77-1, NUR77-2, Nur, TI, TIS1, TR, TR3, nur77)
  • Promoter MSCV-LTR
  • Tag / Fusion Protein
    • HA tag (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer pLXSN: cccttgaacctcctcgttcgacc
  • 3′ sequencing primer MSCV Rev: cagcggggctgctaaagcgcatgc
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry

Depositor Comments

Please note: Plasmid contains a 36bp deletion in the PGK promoter. This deletion is not known to affect plasmid function.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    MSCV-HA-Nr4a1-Zf2 was a gift from Matthew Steinhauser (Addgene plasmid # 160944 ; ; RRID:Addgene_160944)
  • For your References section:

    Targeting nuclear receptor NR4A1-dependent adipocyte progenitor quiescence promotes metabolic adaptation to obesity. Zhang Y, Federation AJ, Kim S, O'Keefe JP, Lun M, Xiang D, Brown JD, Steinhauser ML. J Clin Invest. 2018 Nov 1;128(11):4898-4911. doi: 10.1172/JCI98353. Epub 2018 Oct 2. 10.1172/JCI98353 PubMed 30277475