pEDJ-87
(Plasmid
#163085)
-
PurposeMarkerFree plasmid for integration of pADH1-MCP-VPR into site XI-5
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 163085 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepCfB3037
- Backbone size w/o insert (bp) 4547
- Total vector size (bp) 7293
-
Vector typeYeast Expression
-
Selectable markersNone
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameVPR
-
Insert Size (bp)1596
- Promoter ADH1
-
Tag
/ Fusion Protein
- MCP (N terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer gaaattcgcttatttagaagtgtc
- 3′ sequencing primer CTCCTTCCTTTTCGGTTAGAG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note that the Addgene verified sequence differs from the depositor's reference sequence. These differences do not affect plasmid function.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEDJ-87 was a gift from Michael Jensen (Addgene plasmid # 163085 ; http://n2t.net/addgene:163085 ; RRID:Addgene_163085) -
For your References section:
Transcriptional reprogramming in yeast using dCas9 and combinatorial gRNA strategies. Jensen ED, Ferreira R, Jakociunas T, Arsovska D, Zhang J, Ding L, Smith JD, David F, Nielsen J, Jensen MK, Keasling JD. Microb Cell Fact. 2017 Mar 15;16(1):46. doi: 10.1186/s12934-017-0664-2. 10.1186/s12934-017-0664-2 PubMed 28298224