Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pAAV-CAG-GFP-mirMecp2
(Plasmid #163704)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 163704 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pAAV
  • Vector type
    AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    mirMecp2 and EGFP
  • gRNA/shRNA sequence
    TGCTGTTCACCTGAACACCTTCTGATGTTTTGGCCACTGACTGACATCAGAAGGTTCAGGTGAA
  • Species
    M. musculus (mouse); Aequorea victoria
  • Entrez Gene
    Mecp2 (a.k.a. 1500041B07Rik, D630021H01Rik, Mbd5, WBP10)
  • Promoter CAG

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsrGI (not destroyed)
  • 3′ cloning site EcoRV (destroyed during cloning)
  • 5′ sequencing primer EGFP-C
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-CAG-GFP-mirMecp2 was a gift from Michisuke Yuzaki (Addgene plasmid # 163704 ; http://n2t.net/addgene:163704 ; RRID:Addgene_163704)
  • For your References section:

    MeCP2 Levels Regulate the 3D Structure of Heterochromatic Foci in Mouse Neurons. Ito-Ishida A, Baker SA, Sillitoe RV, Sun Y, Zhou J, Ono Y, Iwakiri J, Yuzaki M, Zoghbi HY. J Neurosci. 2020 Nov 4;40(45):8746-8766. doi: 10.1523/JNEUROSCI.1281-19.2020. Epub 2020 Oct 12. 10.1523/JNEUROSCI.1281-19.2020 PubMed 33046553