pEF-ABEmax
(Plasmid
#164415)
-
PurposeEF1alpha promoter + ABEmax (derived from #112095). Mammalian cell adenosine base editor expression vector.
-
Depositing Lab
-
Depositing OrganizationArizona State University
Located in United States of America -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 164415 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backboneDerived from pCMV-ABEmax (Addgene #112095)
-
Vector typeMammalian Expression, CRISPR, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameABEmax
-
Alt nameCas9 Adenosine Base Editor max
- Promoter EF1-alpha
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SpeI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer TAGTCGCCGTGAACGTTCTTT
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEF-ABEmax was a gift from Xiao Wang (Addgene plasmid # 164415 ; http://n2t.net/addgene:164415 ; RRID:Addgene_164415) -
For your References section:
A Cas9-mediated adenosine transient reporter enables enrichment of ABE-targeted cells. Brookhouser N, Nguyen T, Tekel SJ, Standage-Beier K, Wang X, Brafman DA. BMC Biol. 2020 Dec 14;18(1):193. doi: 10.1186/s12915-020-00929-7. 10.1186/s12915-020-00929-7 PubMed 33317513