CN1851-rAAV-hI56i-minBglobin-iCre-4X2C-WPRE3-BGHpA
(Plasmid
#164450)
-
PurposeAAV vector for Cre expression in forebrain GABAergic interneurons. For use in combination with Cre-dependent transgenic mouse lines or co-infection with Cre dependent viral vectors.
-
Depositing Labs
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 164450 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
AAV PHP.eB | 164450-PHPeB | Virus (100 µL at titer ≥ 1×10¹³ vg/mL) and Plasmid. | $405 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonerAAV-hI56i-minBglobin-iCre-4X2C-WPRE3-BGHpA
-
Backbone manufacturerAllen Institute for Brain Science
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameiCre
-
SpeciesSynthetic
-
Insert Size (bp)1059
- Promoter minBetaGlobin
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Unknown (unknown if destroyed)
- 5′ sequencing primer AGCGCACGAGGGAGCTT
- 3′ sequencing primer GAGCCACGGAATTGTCAGTG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Funded by BRAIN initiative.
Information for AAV PHP.eB (Catalog # 164450-PHPeB) ( Back to top )
Purpose
Ready-to-use AAV PHP.eB particles produced from CN1851-rAAV-hI56i-minBglobin-iCre-4X2C-WPRE3-BGHpA (#164450). In addition to the viral particles, you will also receive purified CN1851-rAAV-hI56i-minBglobin-iCre-4X2C-WPRE3-BGHpA plasmid DNA.
minBetaGlobin-driven expression of Cre in forebrain GABAergic interneurons. For use in combination with Cre-dependent transgenic mouse lines or co-infection with Cre dependent viral vectors. These AAV were produced with the PHPeB serotype, which permits efficient transduction of the central nervous system. These AAV preparations are suitable purity for injection into animals.Delivery
- Volume 100 µL
- Titer ≥ 1×10¹³ vg/mL
- Pricing $375 USD for preparation of 100 µL virus + $30 USD for plasmid.
- Storage Store at -80℃. Thaw just before use and keep on ice.
- Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.
Viral Production & Use
-
Packaging Plasmids
encode adenoviral helper sequences and AAV rep gene, PHP.eB cap gene
pUCmini-iCAP-PHP.eB (plasmid #103005) - Buffer PBS + 0.001% Pluronic F-68
- Serotype PHPeB (plasmid #103005)
- Purification Iodixanol gradient ultracentrifugation
Biosafety
Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Viral Quality Control
- Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
- Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.
Visit our viral production page for more information.
Addgene Comments
Citation Information: When using the PHP.eB serotype in future publications, please acknowledge Viviana Gradinaru and cite Chan et al., Nat Neurosci, 20(8):1172-1179. Pubmed.These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CN1851-rAAV-hI56i-minBglobin-iCre-4X2C-WPRE3-BGHpA was a gift from The Allen Institute for Brain Science & Jonathan Ting (Addgene plasmid # 164450 ; http://n2t.net/addgene:164450 ; RRID:Addgene_164450)
For viral preps, please replace (Addgene plasmid # 164450) in the above sentence with: (Addgene viral prep # 164450-PHPeB)
-
For your References section:
Enhancer viruses for combinatorial cell-subclass-specific labeling. Graybuck LT, Daigle TL, Sedeno-Cortes AE, Walker M, Kalmbach B, Lenz GH, Morin E, Nguyen TN, Garren E, Bendrick JL, Kim TK, Zhou T, Mortrud M, Yao S, Siverts LA, Larsen R, Gore BB, Szelenyi ER, Trader C, Balaram P, van Velthoven CTJ, Chiang M, Mich JK, Dee N, Goldy J, Cetin AH, Smith K, Way SW, Esposito L, Yao Z, Gradinaru V, Sunkin SM, Lein E, Levi BP, Ting JT, Zeng H, Tasic B. Neuron. 2021 Mar 23. pii: S0896-6273(21)00159-8. doi: 10.1016/j.neuron.2021.03.011. 10.1016/j.neuron.2021.03.011 PubMed 33789083