pSpCas9(BB)-2A-Puro(PX459)-GJA1 sgRNA
(Plasmid #164471)

• Purpose: Expresses sgRNA targeting human GJA1 locus
• Depositing Lab: Markus Kuehn
• Publication: Cheng et al Stem Cells. 2022 Mar 9. pii: 6545973. doi: 10.1093/stmcls/sxac017.

Backbone

• Vector backbone: pSpCas9(BB)-2A-Puro (PX459)
• Backbone manufacturer: Feng Zhang
• Backbone size w/o insert (bp): 9200
• Total vector size (bp): 9220
• Modifications to backbone: Insertion of a sgRNA sequence targeting GJA1
• Vector type: Mammalian Expression
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Gap junction alpha-1 (GJA1)
• Alt name: CX43
• gRNA/shRNA sequence: AAGCCTACTCAACTGCTGGA
• Species: H. sapiens (human)
• GenBank ID: NM_000165.5
• Entrez Gene: GJA1 (a.k.a. AVSD3, CMDR, CX43, EKVP, EKVP3, GJAL, HLHS1, HSS, ODDD, PPKCA)
• Promoter: U6

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BbsI (destroyed during cloning)
• 3′ cloning site: BbsI (destroyed during cloning)
• 5′ sequencing primer: GAGGGCCTATTTCCCATGATTCC

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Matthew R. Cring

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

A student in University of Iowa did this cloning.