Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

MSCVpuro-6xHis_SUMO2
(Plasmid #164938)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 164938 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    MSCVpuro
  • Backbone size w/o insert (bp) 6325
  • Total vector size (bp) 6649
  • Vector type
    Retroviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Small Ubiquitin Like Modifier 2
  • Alt name
    SUMO-2
  • Species
    H. sapiens (human)
  • GenBank ID
    NM_006937.4 NM_006937.4
  • Entrez Gene
    SUMO2 (a.k.a. HSMT3, SMT3B, SMT3H2, SUMO3, Smt3A)
  • Promoter PGK promoter
  • Tag / Fusion Protein
    • 6XHIS (N terminal on insert)

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer CCCTTGAACCTCCTCGTTCGACC
  • 3′ sequencing primer GACAAATGGAAGTAGCACGTCTC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    MSCVpuro-6xHis_SUMO2 was a gift from Ji Luo (Addgene plasmid # 164938 ; http://n2t.net/addgene:164938 ; RRID:Addgene_164938)
  • For your References section:

    Oncogenesis driven by the Ras/Raf pathway requires the SUMO E2 ligase Ubc9. Yu B, Swatkoski S, Holly A, Lee LC, Giroux V, Lee CS, Hsu D, Smith JL, Yuen G, Yue J, Ann DK, Simpson RM, Creighton CJ, Figg WD, Gucek M, Luo J. Proc Natl Acad Sci U S A. 2015 Apr 7;112(14):E1724-33. doi: 10.1073/pnas.1415569112. Epub 2015 Mar 24. 10.1073/pnas.1415569112 PubMed 25805818