pENTR-D-TOPO-kcnn1a
(Plasmid
#164956)
-
PurposeZebrafish kcnn1a gene CDS
-
Depositing Lab
-
Depositing OrganizationPurdue University
Located in United States of America -
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 164956 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepENTR-D-TOPO
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 2580
- Total vector size (bp) 5253
-
Vector typePCR cloning vector
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namekcnn1a
-
Alt namesi:rp71-39b20.3
-
SpeciesD. rerio (zebrafish)
-
Insert Size (bp)2673
-
Entrez Genekcnn1a (a.k.a. si:rp71-39b20.3)
Cloning Information
- Cloning method TOPO Cloning
- 5′ sequencing primer M13F
- 3′ sequencing primer M13R
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The DNA sequence was amplified from pooled wild-type TAB zebrafish embryos. According to the predicted sequence, XP_005171293.1, there are likely polymorphisms, K185E, H323Y, S599N, which are not listed in the current ENSEMBL database. This is possibly due to incomplete zebrafish genome annotation, GRCz11. In addition, at the 5’ end of the insert, there are 44bps extra forward primer dimer sequences (ATGCGGCATCGGCACGCGGGCCATGCGGCATCGGCACGCGGGCC) before the start codon. But this will not impact the result of the whole mount in situ hybridization.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pENTR-D-TOPO-kcnn1a was a gift from GuangJun Zhang (Addgene plasmid # 164956 ; http://n2t.net/addgene:164956 ; RRID:Addgene_164956) -
For your References section:
Phylogenetic and developmental analyses indicate complex functions of Calcium-Activated Potassium Channels in zebrafish embryonic development. Silic MR, Black MM, Zhang G. Dev Dyn. 2021 Mar 16. doi: 10.1002/dvdy.329. 10.1002/dvdy.329 PubMed 33728688