Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #164976)


Item Catalog # Description Quantity Price (USD)
Plasmid 164976 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
  • Backbone size w/o insert (bp) 9519
  • Total vector size (bp) 13380
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy


  • Gene/Insert name
  • Species
    H. sapiens (human)
  • Insert Size (bp)
  • Mutation
    P202A/ F203A
  • GenBank ID
  • Entrez Gene
    NPC1 (a.k.a. NPC, POGZ, SLC65A1)
  • Promoter EF1a
  • Tag / Fusion Protein
    • FLAG (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site XmaI (not destroyed)
  • 5′ sequencing primer TCAAGCCTCAGACAGTGGTTC
  • 3′ sequencing primer CATGCTCCAGACTGCCTTG
  • (Common Sequencing Primers)

Terms and Licenses

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLVX-NPC1(P202A/F203A)-FLAG was a gift from Roberto Zoncu (Addgene plasmid # 164976 ; ; RRID:Addgene_164976)
  • For your References section:

    NPC1-mTORC1 Signaling Couples Cholesterol Sensing to Organelle Homeostasis and Is a Targetable Pathway in Niemann-Pick Type C. Davis OB, Shin HR, Lim CY, Wu EY, Kukurugya M, Maher CF, Perera RM, Ordonez MP, Zoncu R. Dev Cell. 2020 Dec 7. pii: S1534-5807(20)30925-4. doi: 10.1016/j.devcel.2020.11.016. 10.1016/j.devcel.2020.11.016 PubMed 33308480