pLenti KO CLDN1 2xgRNA - spCas9 iRFP670 puro
(Plasmid #166133)

• Purpose: This plasmid allows efficient KO of the cldn1 gene, while expressing the far red fluorescent protein iRFP670 and puromycin resistance
• Depositing Lab: Raphael Gaudin
• Publication: Deffieu et al Hepatology. 2022 Apr 7. doi: 10.1002/hep.32514.

Backbone

• Vector backbone: pLenti spCas9 T2A iRFP670 P2A puro
• Backbone manufacturer: Addgene #122182
• Vector type: Mammalian Expression, Lentiviral, CRISPR
• Selectable markers: Puromycin, Zeocin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: hU6-gRNA and hH1-gRNA targeting cldn1 gene
• gRNA/shRNA sequence: gagcgagtcatggccaacgc and caacagctgcagccccgcgt
• Species: H. sapiens (human)
• GenBank ID: 9076 NG_021418
• Tag / Fusion Protein:
  • iRFP670 (C terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BsmB1 (destroyed during cloning)
• 3′ cloning site: BsmB1 (destroyed during cloning)
• 5′ sequencing primer: gggtttattacagggacagcagag
• 3′ sequencing primer: ggagccaattcccactcctttc

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry