Venus-79aa-ActA-pEGFP-C1
(Plasmid
#166763)
-
PurposeTo target Venus to the mitochondrial outer membrane. ActA tail anchor inserts into the outer membrane and Venus faces the cytosol. Serves as a collisional control in FLIM-FRET experiments.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 166763 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepEGFP-C1
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameActA tail anchor (Listeria monocytogenes)
-
Alt nameVenus-ActA, V-ActA
-
SpeciesSynthetic; Listeria monocytogenes
-
Entrez GeneactA (a.k.a. lmo0204)
- Promoter CMV
-
Tag
/ Fusion Protein
- Venus (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Unknown (unknown if destroyed)
- 3′ cloning site Unknown (unknown if destroyed)
- 5′ sequencing primer TGACGCAAATGGGCGGTAGG
- 3′ sequencing primer TCGCCCTTTGACGTTGGAGTCCAC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made bySee gene entry for "actin assembly-inducing protein ActA" (NCBI Reference Sequence: WP_110138194.1). Here we have used only the C-terminal tail anchor sequence of this protein.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
"SGLRSRGSGLRSRAQASNSAVDARGSGLRSRAQASNSAVDARGSGLRSRAQASNSAVDAR
GSGLRSRAQASNSAVDARV" amino acid targeting sequence, which we refer to as "ActA", for the mitochondrial outer membrane. Pearson's correlation of 0.8-0.9 with mitotracker red signal in cells. "79aa" indicates the 79 amino acid flexible linker region between Venus and the ActA targeting signal.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Venus-79aa-ActA-pEGFP-C1 was a gift from David Andrews (Addgene plasmid # 166763 ; http://n2t.net/addgene:166763 ; RRID:Addgene_166763)