pF-01
(Plasmid
#166931)
-
PurposeGFP coding region part (F)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 166931 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepTwist Amp High Copy
-
Backbone manufacturerTwist Bioscience
- Backbone size w/o insert (bp) 2221
- Total vector size (bp) 2961
-
Vector typeBacterial Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGreen Fluorescent Protein - Block F- Flanked by BsaI sites
-
Alt nameGOI (Gene of Interest) - GFP
-
SpeciesSynthetic
-
Insert Size (bp)740
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer TCATGCATAATCCGCACGCATC (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pF-01 was a gift from Thomas Gorochowski (Addgene plasmid # 166931 ; http://n2t.net/addgene:166931 ; RRID:Addgene_166931) -
For your References section:
Harnessing the central dogma for stringent multi-level control of gene expression. Greco FV, Pandi A, Erb TJ, Grierson CS, Gorochowski TE. Nat Commun. 2021 Mar 19;12(1):1738. doi: 10.1038/s41467-021-21995-7. 10.1038/s41467-021-21995-7 PubMed 33741937