Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pBLADE_ONLY_A
(Plasmid #168051)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 168051 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pTrc99a
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Blue light-inducible AraC dimers in Escherichia coli
  • Alt name
    BLADE
  • Species
    Synthetic
  • Insert Size (bp)
    828
  • Promoter J23101**

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ATGCATACGCTCTACGCTCC
  • 3′ sequencing primer TCGGGTGACTGAAGAAAACGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBLADE_ONLY_A was a gift from Barbara Di Ventura (Addgene plasmid # 168051 ; http://n2t.net/addgene:168051 ; RRID:Addgene_168051)
  • For your References section:

    Engineering AraC to make it responsive to light instead of arabinose. Romano E, Baumschlager A, Akmeric EB, Palanisamy N, Houmani M, Schmidt G, Ozturk MA, Ernst L, Khammash M, Di Ventura B. Nat Chem Biol. 2021 Apr 26. pii: 10.1038/s41589-021-00787-6. doi: 10.1038/s41589-021-00787-6. 10.1038/s41589-021-00787-6 PubMed 33903769