Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pBAD-DiB1
(Plasmid #168800)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 168800 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pBAD
  • Backbone size w/o insert (bp) 3958
  • Total vector size (bp) 4492
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Fluorogen activating protein DiB1
  • Species
    Synthetic
  • Insert Size (bp)
    534
  • GenBank ID
  • Promoter araBAD
  • Tag / Fusion Protein
    • His-tag (N terminal on insert)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer ATGCCATAGCATTTTTATCC
  • 3′ sequencing primer GATTTAATCTGTATCAGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBAD-DiB1 was a gift from Alexander Mishin (Addgene plasmid # 168800 ; http://n2t.net/addgene:168800 ; RRID:Addgene_168800)
  • For your References section:

    Protein labeling for live cell fluorescence microscopy with a highly photostable renewable signal. Bozhanova NG, Baranov MS, Klementieva NV, Sarkisyan KS, Gavrikov AS, Yampolsky IV, Zagaynova EV, Lukyanov SA, Lukyanov KA, Mishin AS. Chem Sci. 2017 Oct 1;8(10):7138-7142. doi: 10.1039/c7sc01628j. Epub 2017 Aug 3. 10.1039/c7sc01628j PubMed 29147545