Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

cpLOV2-V5
(Plasmid #168991)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 168991 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    mCherry2-N1
  • Backbone size w/o insert (bp) 4728
  • Total vector size (bp) 5188
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    cpLOV2-V5
  • Species
    Synthetic
  • Insert Size (bp)
    462
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (unknown if destroyed)
  • 3′ cloning site EcoRI (unknown if destroyed)
  • 5′ sequencing primer CMVf: CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    cpLOV2-V5 was a gift from Yubin Zhou (Addgene plasmid # 168991 ; http://n2t.net/addgene:168991 ; RRID:Addgene_168991)
  • For your References section:

    Circularly permuted LOV2 as a modular photoswitch for optogenetic engineering. He L, Tan P, Zhu L, Huang K, Nguyen NT, Wang R, Guo L, Li L, Yang Y, Huang Z, Huang Y, Han G, Wang J, Zhou Y. Nat Chem Biol. 2021 Aug;17(8):915-923. doi: 10.1038/s41589-021-00792-9. Epub 2021 May 6. 10.1038/s41589-021-00792-9 PubMed 33958793