pProkR2.Cre.T2A.Venus
(Plasmid
#169014)
-
PurposeExpresses Cre under Prok receptor 2 minimal promoter in mammalian cells
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 169014 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneN/A
-
Backbone manufacturerVectorBuilder
- Backbone size w/o insert (bp) 5282
- Total vector size (bp) 7124
-
Vector typeMammalian Expression, AAV, Cre/Lox
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCre Recombinase
-
Insert Size (bp)1842
- Promoter Prokineticin Receptor 2
-
Tags
/ Fusion Proteins
- T2A
- Venus
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer ctggccttttgctcacatgt (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byThe ProkR2 promoter sequence was determined by Antony Adamson (University of Manchester, UK) and the plasmid was constructed by VectorBuilder.
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pProkR2.Cre.T2A.Venus was a gift from Michael Hastings (Addgene plasmid # 169014 ; http://n2t.net/addgene:169014 ; RRID:Addgene_169014)