Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pNB208
(Plasmid #169119)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 169119 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pNB200
  • Backbone size w/o insert (bp) 2400
  • Vector type
    Bacterial Expression, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    trpD
  • Alt name
    Rv2192c
  • Alt name
    Anthranilate synthase
  • Species
    Mycobacterium tuberculosis H37Rv
  • Insert Size (bp)
    1113
  • Mutation
    Codon optimized for E. coli
  • Entrez Gene
    trpD (a.k.a. Rv2192c)
  • Promoter pBAD

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsaI (destroyed during cloning)
  • 3′ cloning site BsaI (destroyed during cloning)
  • 5′ sequencing primer GATTAGCGGATCCTACCTGACG
  • 3′ sequencing primer AGGCCCAGTCTTTCGACTGAGC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://doi.org/10.1101/2021.03.26.437171 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pNB208 was a gift from Edwin Wintermute (Addgene plasmid # 169119 ; http://n2t.net/addgene:169119 ; RRID:Addgene_169119)
  • For your References section:

    Low-cost anti-mycobacterial drug discovery using engineered E. coli. Bongaerts N, Edoo Z, Abukar AA, Song X, Sosa-Carrillo S, Haggenmueller S, Savigny J, Gontier S, Lindner AB, Wintermute EH. Nat Commun. 2022 Jul 7;13(1):3905. doi: 10.1038/s41467-022-31570-3. 10.1038/s41467-022-31570-3 PubMed 35798732