Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pSP618
(Plasmid #169235)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 169235 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pMJ114
  • Total vector size (bp) 9205
  • Modifications to backbone
    U6-sgRNA cassette was replaced with Spear-ATAC U6-sgRNA cassette including flanking Nextera sequencing adapters
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Selectable markers
    Puromycin ; BFP

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    mU6-sgRNA
  • gRNA/shRNA sequence
    GCGAACTTAATCCCGTGGCAA

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSP618 was a gift from William Greenleaf (Addgene plasmid # 169235 ; http://n2t.net/addgene:169235 ; RRID:Addgene_169235)
  • For your References section:

    High-throughput single-cell chromatin accessibility CRISPR screens enable unbiased identification of regulatory networks in cancer. Pierce SE, Granja JM, Greenleaf WJ. Nat Commun. 2021 May 20;12(1):2969. doi: 10.1038/s41467-021-23213-w. 10.1038/s41467-021-23213-w PubMed 34016988