pgRNAkan-glpR
(Plasmid
#169873)
-
PurposeSingle guide RNA plasmid for Cas9 targeting glpR in P. putida
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 169873 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepBBR1k-GFP
-
Vector typeBacterial Expression, CRISPR, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namesgRNA towards glpR in Pseudomonas putida
-
gRNA/shRNA sequenceggccggggttggtgtccggt
-
SpeciesSynthetic
Resource Information
-
Supplemental Documents
-
Addgene Notes
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pgRNAkan-glpR was a gift from Brian Pfleger (Addgene plasmid # 169873 ; http://n2t.net/addgene:169873 ; RRID:Addgene_169873) -
For your References section:
Stepwise genetic engineering of Pseudomonas putida enables robust heterologous production of prodigiosin and glidobactin A. Cook TB, Jacobson TB, Venkataraman MV, Hofstetter H, Amador-Noguez D, Thomas MG, Pfleger BF. Metab Eng. 2021 Jun 24;67:112-124. doi: 10.1016/j.ymben.2021.06.004. 10.1016/j.ymben.2021.06.004 PubMed 34175462